circad | circRNAs associated with diseases

CDR1as/ciRS-7/mmu_circ_0001878
Gene	Cdr1	Organism	Mouse
Genome Locus	chr11:33307958-33309057:+	Build	n/a
Disease	Myocardial Infarction	ICD-10	Acute myocardial infarction (I21)
DBLink	Link to database	PMID	26998750
Experimental Method
Sample Type	Ischemic Tissues	Comparison	Mice were randomly divided into two groups (n = 10 for each) for control vs ischemic condition
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTGTCTCCAGTGTATCGGCG Reverse TACTGGCACCACTGGAAACC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Geng, HH, Li, R, Su, YM, Xiao, J, Pan, M, Cai, XX, Ji, XP (2016). The Circular RNA Cdr1as Promotes Myocardial Infarction by Mediating the Regulation of miR-7a on Its Target Genes Expression. PLoS ONE, 11, 3:e0151753.